If Rasmol is not installed on this computer you will need to
download Rasmol software.

Click here to view the GCN4 bZip domain bound to the following sequence:

TTCCTATGACTCATCCAGTT
  AGGATACTGAGTAGGTCAAA

In the middle of the sequence is a short imperfect palindrome with the sequence:

TGACTCA
ACTGAGT

This 7 bp sequence is the actual recognition element for GCN4. The symmetry of this sequence reflects the symmetry of the dimeric GCN4 DNA binding domain. In other words, the two different subunits of GCN4 interact with the two different halves of this palindrome in nearly identical ways.

Use the mouse, the RasMol menus, and the command line window to explore the protein:protein interface and the protein:DNA interface. Of particular importance for dictating the specificity of binding are the following amino acids: Asn 235, Ala 238, Ala 239, Ser 242, and Arg 243.

---

voh@chem.ucla.edu // Last revision: November 15, 1996